View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_59 (Length: 321)
Name: NF18317_low_59
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_59 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 19 - 311
Target Start/End: Complemental strand, 48486879 - 48486587
Alignment:
| Q |
19 |
tggttgttgttctgcctgcaagaatatttggcttgtattcgctcatattaagaataatcttgttcagattccaggggcagacccgattgtacaagaccaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486879 |
tggttgttgttctgcctgcaagaatatttggcttgtactcgctcatattaagaataatcttgttcagattccaggggcagacccgattgtacaagaccaa |
48486780 |
T |
 |
| Q |
119 |
aggaagtgactttcacgaggcaatggaggaggcaatgttggcagataatggcattctggatccacattatagagctaagcaaattgtggagggtgcgact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486779 |
aggaagtgactttcacgaggcaatggaggaggcaatgttggcagataatggcattctggatccacattatagagctaagcaaattgtggagggtgcgact |
48486680 |
T |
 |
| Q |
219 |
tcctgtgctgaacaggaatatcactgccaaggccaggtgattttaatttttccacttcgtgttgtgtatgatcatgattcatgactgatgatg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486679 |
tcctgtgctgaacaggaatatcactgccaaggccaggtgattttaatttttccacttcgtgttgtgtatgatcatgattcatgactgatgatg |
48486587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University