View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_67 (Length: 306)
Name: NF18317_low_67
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 7 - 288
Target Start/End: Original strand, 14065806 - 14066087
Alignment:
| Q |
7 |
ggagcagagaagtgatatgaacgagcaatctgatgctcattaatgaacgaaggagaggttttgcggtattaatacatgagaaatcagctactaactgtca |
106 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14065806 |
ggagcaaagaagtgatatgaatgagcaatctgatgctcattaatgaacgaaggagaggttttgcggtattaatacatgagaaatcagctactaactgtca |
14065905 |
T |
 |
| Q |
107 |
taactgaaaagctagaaatgcgggaaattcataactaactgatactgctagataactaactaacaggttgctaatcacttatcattgctacttatcaggt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14065906 |
taactgaaaagctagaaatgcgggaaattcataactaactaaaactgctagataactaactaacaggttgctaatcacttatcattgctacttatcaggt |
14066005 |
T |
 |
| Q |
207 |
taatcttcacagcttatcaagacacatcaaaataaggtggttcacccaatttggactatgtctataggaaacaacaaatttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14066006 |
taatcttcacagcttatcaagacacatcaaaataaggtggttcacccaatttggactatgtctataggaaacaacaaatttc |
14066087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University