View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_69 (Length: 304)
Name: NF18317_low_69
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 5 - 199
Target Start/End: Complemental strand, 29052643 - 29052449
Alignment:
| Q |
5 |
atgaaataaattataagcatgcaacatatatgaataaatgagctggattaacatgaagagaccctcatcatcttcctacttccaccaacatcaacatcat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052643 |
atgaaataaattataagcatgcaacatatatgaataaatgagctggattaacatgaagagaccctcatcatcttcctacttccaccaacatcaacatcat |
29052544 |
T |
 |
| Q |
105 |
ttcttccttattccacaaacccttcgtttagtgcaggtactccaaccaccactggacataagagtataccttgttgcagccttctcccctattgg |
199 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052543 |
ttcttccttattccacaaactcttcgtttagtggaggtactccaaccaccactggacataagagtataccttgttgcagccttctcccctattgg |
29052449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 196 - 288
Target Start/End: Complemental strand, 29052414 - 29052322
Alignment:
| Q |
196 |
ttggtgtttgtcgaagtactggatttgcgagtcattttcttccctctgtcatgcctcaccagttgcagccaagcatcaatggtacctaaattc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29052414 |
ttggtgtttgtcgaagtactggatttgcgagtcattttcttccctctgtcatgcctcaccagttgcagccaagtatcaatggtacctaaattc |
29052322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 33901343 - 33901414
Alignment:
| Q |
13 |
aattataagcatgcaacatatatgaataaatga-gctggattaacatgaagagaccct-catcatcttccta |
82 |
Q |
| |
|
|||||||||||||||||| || | || ||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
33901343 |
aattataagcatgcaacagatcggcatgaatgaagctggattaacatgaagagagcctccatcatcttccta |
33901414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University