View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_76 (Length: 298)
Name: NF18317_low_76
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_76 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 111 - 244
Target Start/End: Original strand, 10388647 - 10388780
Alignment:
| Q |
111 |
gagaattatggagttaggaagttggaaggtgtttttgctattttcattggaactatgggtctttcctttgcatggatgttctttgatacaaagccaagtg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10388647 |
gagaattatggagttaggaagttggaaggtgtttttgctattttcattggaactatgggtctttcctttgcatggatgttctttgatacaaagccaagtg |
10388746 |
T |
|
| Q |
211 |
aagaagaacttcttatgggtacaaatttagcaca |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
10388747 |
aagaagaacttcttatgggtacaaatttatcaca |
10388780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 10388552 - 10388588
Alignment:
| Q |
16 |
ataaattaaaggatggtgaaaatgaatgaatgatata |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10388552 |
ataaattaaaggatggtgaaaatgaatgaatgatata |
10388588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 239 - 281
Target Start/End: Original strand, 10388795 - 10388837
Alignment:
| Q |
239 |
agcacatacatttttataaacttatttcccatgaagcgcacac |
281 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
10388795 |
agcacatacatttttataaacttattttcaatgaagcgcacac |
10388837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University