View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_77 (Length: 296)
Name: NF18317_low_77
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 12 - 279
Target Start/End: Complemental strand, 40954308 - 40954044
Alignment:
| Q |
12 |
gcattaccctcacctcaccatttacattcccactttttcatgctaactcaaccaacttcttcaatcacttcacaaccaccaccacctagtgcattctcca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40954308 |
gcattaccctcacctcaccatttacattcccactttttcatgctaactcaaccaacttcttcaatcacttcacaaccaccacc---tagtgcattctcca |
40954212 |
T |
 |
| Q |
112 |
atcttacaagttttcatttccataactgcatataggataatacttgggtgacattgtgataacattggttattgcttccttcacccaaactttcactact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
40954211 |
atcttacaagttttcatttccataactgtatataggataatacttgggtgacattgtgataacataggttattgcttccttcatccaaactttcactact |
40954112 |
T |
 |
| Q |
212 |
aatgcagttaacgggtttgttcagttttgatatatgggatagtaggttggttattcaatcaatacagt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40954111 |
aatgcagttaacgggtttgttcagttttgatatatgggatagtaggttggttactcaatcaatacagt |
40954044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University