View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_89 (Length: 264)
Name: NF18317_low_89
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_89 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 158 - 247
Target Start/End: Original strand, 34981267 - 34981356
Alignment:
| Q |
158 |
gtttgctatgatttacttttgtagttcagtgaatgaattatgaatgcttgtgagtatgatgtatggacctagaactgcacttcaataatc |
247 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34981267 |
gtttgctgtgatttacttttgtagttcagtgaatgaattatgaatgcttctgagtatgatgtatggacctcgaactgcacttcaataatc |
34981356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 34981166 - 34981253
Alignment:
| Q |
48 |
atgttatatctaattt-gttgtcaaatttaatgtcaatttcaggtattaaaacagagctcgtcaatgtttgttaggaagtatcttctc |
134 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34981166 |
atgttatatctaattttgttgtcaaatttaatgtcaatttcaggtattaaaacagagctcgtcaatgtttgttaggaagtatcctctc |
34981253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University