View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18317_low_98 (Length: 251)
Name: NF18317_low_98
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18317_low_98 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 24 - 233
Target Start/End: Original strand, 25896935 - 25897143
Alignment:
| Q |
24 |
gctttgttttttggtccaaatcttatatcctggtggtccagaaaacaatctgttgtggctcgttctagtgcaaaagtataataccgtagccttgctctaa |
123 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25896935 |
gctttgttttttggttcaaatcttatatcctggtggtccagaaaacaatctgttgtggctcgttctagtgcaaaagtatagtaccgtagccttgctctaa |
25897034 |
T |
|
| Q |
124 |
tcactgcagaaatcctttaggttaagactcttctacaagagcttcaagttcctattgcttccccccttatactgtgataatcaaagtactctggctatgg |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25897035 |
tcactgcagaaatccttta-gttaagactctcctacaagagcttcaagttcctattgcttccccccttatactgtgataatcaaagtactctggctatgg |
25897133 |
T |
|
| Q |
224 |
cacacaaccc |
233 |
Q |
| |
|
|||||||||| |
|
|
| T |
25897134 |
cacacaaccc |
25897143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University