View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18318_high_21 (Length: 329)
Name: NF18318_high_21
Description: NF18318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18318_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 12 - 312
Target Start/End: Original strand, 25701655 - 25701955
Alignment:
| Q |
12 |
atgaagatccaaaatagccactctatacgcacaatggttaccttttttgaaaatatttcatctgccatgcagttgatccagcgatttcttaaaggccaag |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25701655 |
atgaagatccaaaatagccactctatatgcacaatggttaccttttttgaaaatatttcatctgccatgcagttgatccagcgatttcttaaaggccaag |
25701754 |
T |
|
| Q |
112 |
gcaaaatgccatcgttcgtgtaagcttgtcagttcattggtaattagactcaatcccaaattcattcaacctttttaataagcctgttcaatagcagttg |
211 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25701755 |
gcacaatgccattgttcgtgtaagcttgtcagttcattggtaattagactcaatcccaaattcattcaacctttttaataagcctgttcaatagaagttg |
25701854 |
T |
|
| Q |
212 |
ttgtggagaaagtggaagcatatcgtatggttataagttgtgtgggtttttggttagcaaggaacaacttagttttttatggagaaggaacatattgttt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25701855 |
ttgtggagaaagtggaagcatatcgtatggttataaattgtgtgggtttttggttagcaaggaacaacttagttttttatggagaaggaacatattgttt |
25701954 |
T |
|
| Q |
312 |
t |
312 |
Q |
| |
|
| |
|
|
| T |
25701955 |
t |
25701955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University