View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18318_high_32 (Length: 256)
Name: NF18318_high_32
Description: NF18318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18318_high_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 12 - 151
Target Start/End: Original strand, 9667725 - 9667864
Alignment:
| Q |
12 |
cagagaaagagagtggcaagaaactagtgtttgaaaggannnnnnn-ctgtgtctggaatatggatttagaattgaatgggcttaaagaactagaagatg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
9667725 |
cagagaaagagagtggcaagaaactagtgtttgaaaggattttttttctgtgtctggaatatggattg-gaattgaatgggcttaaagaactggaagatg |
9667823 |
T |
 |
| Q |
111 |
gactttgagaaatggcttatgtttttccaaagctaaggggg |
151 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9667824 |
gactatgagaaatggcttatgtttttccaaagctaaggggg |
9667864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University