View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18318_low_18 (Length: 406)
Name: NF18318_low_18
Description: NF18318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18318_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 4e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 167 - 388
Target Start/End: Complemental strand, 32082684 - 32082458
Alignment:
| Q |
167 |
gtttttctagcggtacgtaccattccattaacatt------catccatgcacattctttttatttattacgtatcaggtatcctcagcatgcaactgcaa |
260 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32082684 |
gtttttctagcggtacgtaccataccattaacattaacattcatccatgcacattctttttatttattacgtatcaggtatcctctgcatgcaactgcaa |
32082585 |
T |
|
| Q |
261 |
cataaaatatttttatatgatatgattttgnnnnnnngatcaggtttggagatgaggaatggtgatggattaaagatgccaaagttcgttgtaattggac |
360 |
Q |
| |
|
| |||||||| ||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32082584 |
cgtaaaatatctttatttgatatgattttgtttttt-gatcaggtttggagatgagcaatggtgatggattaaagatgccaaagttcgttgtaattggac |
32082486 |
T |
|
| Q |
361 |
atagaggaaacggtatgaatgtcttaca |
388 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32082485 |
atagaggaaacggtatgaatgtcttaca |
32082458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University