View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18318_low_32 (Length: 258)
Name: NF18318_low_32
Description: NF18318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18318_low_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 9080909 - 9080665
Alignment:
| Q |
1 |
atatatacaagttagtccacatatatgcatgggtgtattattaatatattatatcttttgagaaaagggg-ttggcatgcacttacagacaaagcattag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
9080909 |
atatatacaagttagtccacatatatgcatgggtgtattattaatatattatatcttttgagaaaggaagattggcatgcacttacagacaaagcattag |
9080810 |
T |
 |
| Q |
100 |
gaattcttgttttccaaggtctccaccctaacatgttatacttgtttttgttgggaacatatattgaatgtgcttcctcttcctct--ctatatataatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||| |||||||||||| |
|
|
| T |
9080809 |
gaattcttgttttccaaggtctccaccctaacatgttatacttgtttttgttgggaacatatattgaatgtg-tttctctccctctccctatatataatg |
9080711 |
T |
 |
| Q |
198 |
tctcaaaggaacattgtacgttatagacataaccactactatttct |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9080710 |
tctcaaaggaacattgtacgttatagatataaccactactatttct |
9080665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University