View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18318_low_33 (Length: 256)

Name: NF18318_low_33
Description: NF18318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18318_low_33
NF18318_low_33
[»] chr3 (1 HSPs)
chr3 (12-151)||(9667725-9667864)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 12 - 151
Target Start/End: Original strand, 9667725 - 9667864
Alignment:
12 cagagaaagagagtggcaagaaactagtgtttgaaaggannnnnnn-ctgtgtctggaatatggatttagaattgaatgggcttaaagaactagaagatg 110  Q
    |||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||  ||||||||||||||||||||||| |||||||    
9667725 cagagaaagagagtggcaagaaactagtgtttgaaaggattttttttctgtgtctggaatatggattg-gaattgaatgggcttaaagaactggaagatg 9667823  T
111 gactttgagaaatggcttatgtttttccaaagctaaggggg 151  Q
    |||| ||||||||||||||||||||||||||||||||||||    
9667824 gactatgagaaatggcttatgtttttccaaagctaaggggg 9667864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University