View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_high_30 (Length: 308)
Name: NF1831_high_30
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 14495072 - 14495281
Alignment:
| Q |
1 |
aaaactacaaaaggttgaagagtttcagaattagaagctctttgtgggaaaaaggaagagaatctttaaaagaaaggaaaacatataagagaaatacagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495072 |
aaaactacaaaaggttgaagagtttcagaattagaagctctttgtgggaaaaaggaagagaatctttaaaagaaaggaaaacatataagagaaatacagt |
14495171 |
T |
 |
| Q |
101 |
tcattattcgaattcactaggcatgcgtgtaatgtcccaaagtattaaagtgaataaagtggtgcatgttgttaactaagactagacattgtacaacact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495172 |
tcattattcgaattcactaggcatgcgtgtaatgtcccaaagtattaaagtgaataaagtggtgcatgttgttaactaagactagacattgtacaacact |
14495271 |
T |
 |
| Q |
201 |
ttgttgcact |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
14495272 |
ttgttgcact |
14495281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 263 - 297
Target Start/End: Original strand, 14495334 - 14495368
Alignment:
| Q |
263 |
atcttggaatgaaaacataaaataacttcccctat |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495334 |
atcttggaatgaaaacataaaataacttcccctat |
14495368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University