View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_high_38 (Length: 278)
Name: NF1831_high_38
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_high_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 45 - 273
Target Start/End: Complemental strand, 25803984 - 25803756
Alignment:
| Q |
45 |
aagcatattcttgatcttaatacatgcaagttttttgtttgacccaggcatagacttaaggcattcacatacatgcttcaaacataaatcacaccgtgtc |
144 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25803984 |
aagcatattcttgatattaatacatgcaagttttttgtttgacccaggcatagacttaaggcattcacatacatgcttcaaacataaatcacaccgtgtc |
25803885 |
T |
|
| Q |
145 |
tgagcataattccacaaaactgtaagccatgacatagaattaagcttcatttacaatcatcagatttaatattactgtcgttaatgtaactatgttttgt |
244 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25803884 |
tgagcataattccacaaaattgtaagccatgacatagaattaagcttcatttacaatcatcagatttaatattactgtcattaatgtaactatgttttgt |
25803785 |
T |
|
| Q |
245 |
gcagcacctttggtatatcctatgctact |
273 |
Q |
| |
|
||||||||||||||||||| ||||||||| |
|
|
| T |
25803784 |
gcagcacctttggtatatcttatgctact |
25803756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University