View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_low_16 (Length: 418)
Name: NF1831_low_16
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 158 - 404
Target Start/End: Complemental strand, 37464209 - 37463963
Alignment:
| Q |
158 |
ccctccaaaaccatcttgatcccctccttttcccccaacacgatagtaaccaaaacaaacattatccaaggcttttgtaaacttcctcgcgtccataaca |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37464209 |
ccctccaaaaccatcttgatcccctccttttgccccaacacgatagtaaccaaaataaacattatccaaggcttttgtcaacttcctcgcgtccataaca |
37464110 |
T |
 |
| Q |
258 |
ttgatgaacctcacaaacgcataaatttgatcatgagtgtttcaattttgagcaacatatagacatctgacaaaattccatagaccataaaaccctttcg |
357 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
37464109 |
ttgatgaacctcacaaacgcataagcttgaccatgagtgtttcaattttgagcaacatatagacatctgacaaaatcccatagaccataaaatcctttcg |
37464010 |
T |
 |
| Q |
358 |
taacttaacataagaaattttttctagaaaattagtagagtaaaagg |
404 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37464009 |
taacttaacataagaagttttttctagaaaattagtagagtaaaagg |
37463963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 37468023 - 37467988
Alignment:
| Q |
11 |
aagaatcgcatctactggagtaaggcggtgtaggaa |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37468023 |
aagaatcgcatctactggagtaaggcggtgtaggaa |
37467988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University