View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_low_28 (Length: 337)
Name: NF1831_low_28
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 23918322 - 23918001
Alignment:
| Q |
1 |
catatccacagttcttttctttgctccagtgactcgtccatctaccgcnnnnnnncttaatttcatcaagaaggtagaatgtgaaagagcagcttccatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23918322 |
catatccacagttcttttctttgctccagtgactcgtccatctaccgctttttttcttaatttcatcaagaaggtagaatgtgaaatagcagcttccatc |
23918223 |
T |
 |
| Q |
101 |
atccttctccggcgaagctaaactattcatggtagctgcaagaacctttctgtcactgttgatcacaaaatgaaacaatggtagtccattttttattgtt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23918222 |
atccttctccggtgaagctaaactattcatggtagctgcaagaacctttctttcactgttgatcacaaaatgaaacaatggcagtccattttttattgtt |
23918123 |
T |
 |
| Q |
201 |
agttgcaagagggctttaattgatgattgcttatttgttcgaaagctcgttgaatttgggctacctatcggtgtcaaactgctttcggatgaatggtgtt |
300 |
Q |
| |
|
|||||||| || |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23918122 |
agttgcaaaagagctttaattgatgattctttatttgttcgaaagctcgttgaatttgggctacctatcggtgtcaaactgctttcggatgaatggtgtt |
23918023 |
T |
 |
| Q |
301 |
gtgcgtttgatgccttattctt |
322 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
23918022 |
gtgtgtttgatgccttattctt |
23918001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University