View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_low_40 (Length: 290)
Name: NF1831_low_40
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 21397037 - 21396777
Alignment:
| Q |
11 |
catcatcaatcatatttcaattttttctactacaataaatgccaagttaggggagatctagttttggggtgtcggtggtgaatgcgttattattgtcatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21397037 |
catcatcaatcatatttcaattttttctactacaataaatgccaagttaggggagatctagttttggggtgtcggtggtgaatgcgttattattgtcatt |
21396938 |
T |
 |
| Q |
111 |
cataataattattaacttcctgaatcttggtcatttaataagttcatgggggtctcatagatgtgtcagatagcagctgctataccagccaaaatatatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21396937 |
cataataattattaacttcctgaatcttggtcatttaataagttcatgggggtctcatagatgtgtcagatagcagctgctataccagccaaaatatatc |
21396838 |
T |
 |
| Q |
211 |
tagaaaatgttatggttaaaccagagatgcattgtgcttgtagacaggctgtagaaactac |
271 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21396837 |
tagaaaatgctatggttaaaccagagatgcattgtgcttgtagacaggctgtagaaactac |
21396777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University