View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_low_46 (Length: 268)
Name: NF1831_low_46
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 256
Target Start/End: Complemental strand, 32571201 - 32570966
Alignment:
| Q |
21 |
ttcccttatctttttccatttctgcataatcttttggaccatttgttcttcttctgccatttggaccccatgctgtggaaaagaaagaaaaaacagcaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32571201 |
ttcccttatctttttccatttctgcataatcttttggaccatttgttcttcttctgccatttggaccccatgctgtggaaaagaaagaaaaaacagcaaa |
32571102 |
T |
|
| Q |
121 |
ccattctcatgaaaattgtttctttcttcaaactctatcctttaacaacggaatcttcatttcacacacataatatattaacacaatacacgtgtttatg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32571101 |
ccattctcatgaaaattgtttctttcttcaaactttaacctttaacaacggaatcttcatttcacacacataatatattaacacaatacacgtgtttatg |
32571002 |
T |
|
| Q |
221 |
tttagccaaaacattatcatcaccttttccttgatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32571001 |
tttagccaaaacattatcatcaccttttccttgatg |
32570966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University