View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_low_49 (Length: 245)
Name: NF1831_low_49
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_low_49 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 31135884 - 31136094
Alignment:
| Q |
1 |
attttctataaatgttattttgatacatattgctnnnnnnntcaattttgtctgaaactccaaatannnnnnnaactatatcatgcttcatgtgaaatgc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31135884 |
attttctataaatgttattt-gatacatattgctaaaaaaatcaattttgtctgaaactccaaatatttttttaactatatcatgcttcatgtgaaatgc |
31135982 |
T |
|
| Q |
101 |
caactacttcactagtgttcttattgaccgtatatgttttgtatttttcattgattatgttatgattgtaacagagtaattcaatattggataataagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31135983 |
caactacttcactagtgttcttattgaccgtatatgttttatatttttcattgattatgttattattgttacagagtaattcaatattggataataagtg |
31136082 |
T |
|
| Q |
201 |
gttagttaactg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31136083 |
gttagttaactg |
31136094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 177 - 228
Target Start/End: Complemental strand, 6072803 - 6072752
Alignment:
| Q |
177 |
taattcaatattggataataagtggttagttaactgttcgagttagttaact |
228 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6072803 |
taattcaatgttggttaataagtggttagttaactgttagagttagttaact |
6072752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University