View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_low_52 (Length: 236)
Name: NF1831_low_52
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 4 - 220
Target Start/End: Complemental strand, 27687086 - 27686870
Alignment:
| Q |
4 |
tgatgattttcttgaagattattggcatacacaaaccaagaaactttcttgttttgttggatgagacactcaaagtttgaagctgttgtgtttctttgtt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27687086 |
tgatgattttcttgaagattattggcatacacaaaccaagaaactttcttgttttgttggatgagacactcaaagtttgaagctgttgtgtttctttgtt |
27686987 |
T |
 |
| Q |
104 |
tgtgttttttcagttcaagtacataggtgacagctgttgtgaaaccctcaaataaagacagnnnnnnnaaggtaataattatctttatttaccttgtctc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27686986 |
tgtgttttttcagttcaagtacataggtgacagctgttgtgaaaccctcaaataaagacagtttttttaaggtaataattatctttatttaccttgtctc |
27686887 |
T |
 |
| Q |
204 |
ttggtgaatatcaaagg |
220 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27686886 |
ttggtgaatatcaaagg |
27686870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University