View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1831_low_55 (Length: 227)
Name: NF1831_low_55
Description: NF1831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1831_low_55 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0014 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 2 - 227
Target Start/End: Complemental strand, 73221 - 72995
Alignment:
| Q |
2 |
ttgtatcagttgactcctactacgctactactgtcacctttgttgaccggcttctctattatgactcatgattcaattaagggaaatgttaacgaggtat |
101 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73221 |
ttgtgtcagctgactcctacgacgctactactgtcacctttgttgaccggcttctctattatgactcatgattcaattaagggaaatgttaacgaggtat |
73122 |
T |
|
| Q |
102 |
caactttgctgaaaattccctcaagaatgacatcaaacaaacttaaatcctgcacaactttgctg-atctaccacccctaaaagccttggtagcacgagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
73121 |
caactttgctgaaaattccctcaagaatgacatcaaacaaacttaaatcctgcacaactttgctgaagctaccacccctaaaagccttggtagcacgagg |
73022 |
T |
|
| Q |
201 |
tatcaatccgaggtcaagagaacaaac |
227 |
Q |
| |
|
||||||||| ||||||| ||||||||| |
|
|
| T |
73021 |
tatcaatccaaggtcaacagaacaaac |
72995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 200
Target Start/End: Original strand, 49067680 - 49067770
Alignment:
| Q |
111 |
tgaaaattccctcaagaatgacatcaaacaaacttaaatcctgcacaactttgctg-atctaccacccctaaaagccttggtagcacgagg |
200 |
Q |
| |
|
|||||| ||||||||||||||||| |||| | ||||||||||||||||||||| | ||||||| || |||| |||||||||||||| |
|
|
| T |
49067680 |
tgaaaaatccctcaagaatgacataaaacccggtcaaatcctgcacaactttgctgaagctaccacttctgaaagatttggtagcacgagg |
49067770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University