View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18320_high_13 (Length: 413)
Name: NF18320_high_13
Description: NF18320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18320_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 196 - 396
Target Start/End: Complemental strand, 2896893 - 2896703
Alignment:
| Q |
196 |
caatataggctagagtgacnnnnnnnggtagaatggtataaaggaaaaaagaacacaatgaacaagctgagcctggagtatcaagcctcaacacaatctc |
295 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2896893 |
caatataggctagagtaactttttttggtagaatggtataaaggaaaaaagaacacgaggaacaagctgagcctggagtatcaagcctcaacacagtctc |
2896794 |
T |
 |
| Q |
296 |
cgactgnnnnnnnnnnnnntatatattcaaaaagtcacacctaaccttaaagaacaccctagtttgacagaaaaaatttgcgcatcagttgctcttttaa |
395 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2896793 |
cgactgaaaa----------aaatattcaaaaagtcacacctaaccttaaagaacaccctagtttgacagaaaaaatttgtgcatcagttgctcttttaa |
2896704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 44 - 83
Target Start/End: Complemental strand, 2897051 - 2897012
Alignment:
| Q |
44 |
gtcactaaaagtcaagtttattgtagtgaggtggggcatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2897051 |
gtcactaaaagtcaagtttattgtagtgaggtggggcatc |
2897012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 139 - 170
Target Start/End: Complemental strand, 2896950 - 2896919
Alignment:
| Q |
139 |
taccgaaactgcatttaatccttaaaaaatgg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2896950 |
taccgaaactgcatttaatccttaaaaaatgg |
2896919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University