View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18320_high_26 (Length: 307)
Name: NF18320_high_26
Description: NF18320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18320_high_26 |
 | |
|
| [»] scaffold0212 (1 HSPs) |
| | |
|
| [»] scaffold0015 (1 HSPs) |
| | |
|
| [»] scaffold0082 (1 HSPs) |
| | |
|
| [»] scaffold0221 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0212 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 27462 - 27388
Alignment:
| Q |
21 |
ccagaaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagaccgggaatgagctttacaacc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27462 |
ccagaaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagaccgggaatgagctttacaacc |
27388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 214884 - 214810
Alignment:
| Q |
21 |
ccagaaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagaccgggaatgagctttacaacc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
214884 |
ccagaaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagaccgggaatgagctttacaacc |
214810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 21 - 95
Target Start/End: Original strand, 21957964 - 21958038
Alignment:
| Q |
21 |
ccagaaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagaccgggaatgagctttacaacc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21957964 |
ccagaaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagaccgggaatgagctttacaacc |
21958038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 21 - 93
Target Start/End: Original strand, 24749154 - 24749226
Alignment:
| Q |
21 |
ccagaaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagaccgggaatgagctttacaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24749154 |
ccagaaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagatcgggaatgagctttacaa |
24749226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 100 - 169
Target Start/End: Complemental strand, 14251 - 14182
Alignment:
| Q |
100 |
aacagtgttgaacggaacaacaaatatgtggatctttgtagaaaacataggacatgcgagcacaaaaagc |
169 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14251 |
aacagcgttgaacggaacaacaaatatgtggatctttgtagaaaacataggacatgcgagcacaaaaagc |
14182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 25 - 94
Target Start/End: Original strand, 32858357 - 32858426
Alignment:
| Q |
25 |
aaagatattggactcttttttctttgtcggctgtaaaccaagttgcaagaccgggaatgagctttacaac |
94 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
32858357 |
aaagatattagaatcttttttctttgtcggatgtaaaccaagttgcaagaccgagaatgagctttgcaac |
32858426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 172 - 214
Target Start/End: Complemental strand, 25202 - 25160
Alignment:
| Q |
172 |
tcgacgtggttctctcaagcgccctagtatactctacttgttc |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25202 |
tcgacatggttctctcaagcgccctagtatactctacttgttc |
25160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 35 - 65
Target Start/End: Original strand, 42451549 - 42451579
Alignment:
| Q |
35 |
gactcttttttctttgtcggctgtaaaccaa |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42451549 |
gactcttttttctttgtcggctgtaaaccaa |
42451579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 273
Target Start/End: Complemental strand, 11593153 - 11593117
Alignment:
| Q |
237 |
gtcagttcaccgggaggatcgccctcccaattcgaag |
273 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11593153 |
gtcagttcattgggaggatcgccctcccaattcgaag |
11593117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University