View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18320_high_36 (Length: 242)
Name: NF18320_high_36
Description: NF18320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18320_high_36 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 5026160 - 5026384
Alignment:
| Q |
1 |
tcagtaatttaataaaataagataaaataaaaacatccaacttaattgaaaaatcattcaactcctgggtgtagttatccatatgttttggtgctagagt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5026160 |
tcagtaatttaataaaataaaataaaataaaaacatccaacttaattgaaaaatcattcaactcctgggtgtagttatccatatgttttggtgctagagt |
5026259 |
T |
 |
| Q |
101 |
agataaatcattactatatagagatgttgcttcttaaatcatacaaatctttatggaaaatttcaaacctgaaatgtaatcataattatattttannnnn |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5026260 |
agataaatcattac--tatagagatgttgcttcttaaatcatacaaatctttatggaaaatttcaaacctgaaatgtaatcataattatattttattttt |
5026357 |
T |
 |
| Q |
201 |
nnataaaaccatgtgctactttggaat |
227 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5026358 |
ttataaaaccatgtgctactttggaat |
5026384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University