View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18320_low_34 (Length: 249)
Name: NF18320_low_34
Description: NF18320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18320_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 44 - 235
Target Start/End: Original strand, 24607988 - 24608183
Alignment:
| Q |
44 |
acgttacaatatggtatagcaataatctccgaacaannnnnnnn----agggtgggatgatattgaatggtgtgtgctttgatgatgtatgcttgtttgt |
139 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24607988 |
acgttacaatctggtatagcaataatctccgaacaattaattttttttagggtgggacaatattgaatggtgtgcgctttgatgatgtatgcttgtttgc |
24608087 |
T |
 |
| Q |
140 |
tttctttaatttgtacttcgttttcttatggttgaagattccttatgtgattttaactccctatcttttttcttgtcccactcatcgcatcgcatc |
235 |
Q |
| |
|
||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
24608088 |
tttctttaatttgtacttcattttcttatagtggaagattccttatgtgattttaactccctatcttttttcttgtcccactcatcacatcacatc |
24608183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University