View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18320_low_39 (Length: 207)

Name: NF18320_low_39
Description: NF18320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18320_low_39
NF18320_low_39
[»] chr4 (1 HSPs)
chr4 (18-190)||(36114237-36114409)


Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 190
Target Start/End: Complemental strand, 36114409 - 36114237
Alignment:
18 ggatgtcacacaatgtcaactagatcttccatctagcatagccatgatgcattacccgggatatgacacaatttactcttttaacttattttttatctta 117  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36114409 ggatgtcacacaatgtcaactagatcttccatctaacatagccatgatgcattacccgggatatgacacaatttactcttttaacttattttttatctta 36114310  T
118 atttatacaatcccctgtaatgcaccctttttcatccttataactatatatatcgtagcatttttcattgtct 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36114309 atttatacaatcccctgtaatgcaccctttttcatccttataactatatatatcgtagcatttttcattgtct 36114237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University