View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18320_low_40 (Length: 204)
Name: NF18320_low_40
Description: NF18320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18320_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 24 - 189
Target Start/End: Complemental strand, 5931283 - 5931118
Alignment:
| Q |
24 |
atgatcaacctatgtcacccaaaacatggccaagataaaatccaaatggctgctgccttgttttcttgctctgctcccttgctcccaattacctttgaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5931283 |
atgatcaacctatgtcacccaaaacatggccaagataaaatccaaatggctgctgccttgttttcttgctctgctcccttgctcccaattacctttgaaa |
5931184 |
T |
|
| Q |
124 |
aatggcaaacaaagaagctgaaataagaaacattttggtcaacatgtttcgtacattgttcatctc |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5931183 |
aatggcaaacaaagaagctgaaataagaaacattttggtcaacatgtttcgtacattgttcttctc |
5931118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University