View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18321_high_18 (Length: 251)
Name: NF18321_high_18
Description: NF18321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18321_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 37127083 - 37127319
Alignment:
| Q |
1 |
tgtgcgagctttggtgttggtaccaacagctaagataactttgataacatttttcttagttatattttttgaactatttatctattgatttgagttttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37127083 |
tgtgcgagctttggtgttggtaccaacagcta-gctaactttgataacatttttcttagttatattttttgaactatttatctattgatttgagttttgt |
37127181 |
T |
|
| Q |
101 |
cctatgcagaaaagggtgcaaactatgcagtgcagatcagcaatgtagaaatattacctaaccctgtggtcaggggagagccattcaccttcaaaatcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37127182 |
cctatgcagaaaagggtgcaaactatgcagtgcagatcagcaatgtagaaatattacctaaccctgtggtcaggggagagccattcaccttcaaaatcaa |
37127281 |
T |
|
| Q |
201 |
agcttatactggtcatacttctttccctccttgaattc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37127282 |
agcttatactggtcatacttctttccctccttgaattc |
37127319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 37329521 - 37329406
Alignment:
| Q |
1 |
tgtgcgagctttggtgttggtaccaacagctaagataactttgataacatttttcttagttatattttttgaactatttatctattgatttgagttttgt |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| ||||| || ||| |||| ||| || ||||||||||||||||| | ||||||||| |
|
|
| T |
37329521 |
tgtgcgagctttggtgttgacaccaacagctat-ataactttgatcacattgtttttaattatgtttgttaaactatttatctattgagtagagttttgt |
37329423 |
T |
|
| Q |
101 |
cctatgcagaaaagggt |
117 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37329422 |
gctatgcagaaaagggt |
37329406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University