View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18321_low_16 (Length: 324)
Name: NF18321_low_16
Description: NF18321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18321_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 20 - 316
Target Start/End: Original strand, 22421734 - 22422030
Alignment:
| Q |
20 |
atcatcacaaacagcaacaccaatcccagccaaagaaacattctcacctctcacaacctcctcactcactaaacccttaaaataaaccctaacaaccgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22421734 |
atcatcacaaacagcaacaccaatcccagccaaagaaacactctcacctctcacactctcctcactcactaaacccttaaaataaaccctaacaaccgga |
22421833 |
T |
 |
| Q |
120 |
ctatcatcgttccgactcgtcgaacccgacaaactcccttcaccaaacggtttctcaaaattatccccccatttatcccaatcctccaccggcatgttga |
219 |
Q |
| |
|
| |||| |||||| ||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| ||||||||||| |||||||||||||| |
|
|
| T |
22421834 |
ccttcattgttccgcatcgtcgaacccgaagaactcccttcaccaaacggtttctcgaaattatctccccattcatcccaatccttcaccggcatgttga |
22421933 |
T |
 |
| Q |
220 |
aaatctccgacgccattttctgatcatgaatccgacggttgagatcatctctcgcttcacgcattgctttctcgctttgcagtctgtcgttcatctc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
22421934 |
aaatctccgacgccattttctgatcatgaatccgacggttgagatcgtctctcgcttcacgcattgctctctcgctttgtaatctgtcgttcatctc |
22422030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University