View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18321_low_19 (Length: 301)
Name: NF18321_low_19
Description: NF18321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18321_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 291
Target Start/End: Complemental strand, 43755356 - 43755084
Alignment:
| Q |
19 |
ttaagaagttaagaaagtttgattatgtaagttgaataattgtttttggcataggaatgaaatgaatcattgaaaagagtgaaagaaagaagaacctttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43755356 |
ttaagaagttaagaaagtttgattatgtaagttgaataattgtttttggcataggaattaaatgaatcattgaaaagagtgaaagaaagaagaacctttt |
43755257 |
T |
|
| Q |
119 |
gggagtcattgggttgactttggaactgaaggttgcagctccgaactacgaatttggttcgaagggaaattgttgaagaaagacgaggaagagtggtggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43755256 |
gggagtcattgggttgactttggaactgaaggttgcagctccgaactacgaatttggttcgaagggaaattgttgaagaaagacgaggaagagtggtggt |
43755157 |
T |
|
| Q |
219 |
tggtttgacacgaaacaacgccattcagttcaatgtctcctcctctcaccttctgttttcttccaactctgtg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43755156 |
tggtttgacacgaaacaacgccattcagttcaatgtctcctcctctcaccttctgttttcttccaactctgtg |
43755084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 92 - 217
Target Start/End: Complemental strand, 43759953 - 43759825
Alignment:
| Q |
92 |
aaagagtgaaagaaagaagaaccttttgggagtcattgggttgactttggaactgaaggttgca---gctccgaactacgaatttggttcgaagggaaat |
188 |
Q |
| |
|
|||||||||||||| || ||||||| | ||||||||||| || |||||| |||||||| | ||| ||||| || |||||||||| |||||||| |
|
|
| T |
43759953 |
aaagagtgaaagaaggaggaaccttgcgtgagtcattgggctgcatttggagttgaaggttagaagagcttcgaaccacaaatttggttccaagggaaag |
43759854 |
T |
|
| Q |
189 |
tgttgaagaaagacgaggaagagtggtgg |
217 |
Q |
| |
|
|| ||||| ||| |||||||||||||||| |
|
|
| T |
43759853 |
tgatgaagcaaggcgaggaagagtggtgg |
43759825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University