View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18321_low_22 (Length: 256)
Name: NF18321_low_22
Description: NF18321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18321_low_22 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 317966 - 317745
Alignment:
| Q |
19 |
ggtagagccttttactattactttgttgaagctcaacattccaaagaaacacttccccttcttctttggctcaatggaggtaaaaataatctatctattg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
317966 |
ggtagagccttttactattactttgttgaagctcaacattctaaagaaacacttccccttcttctttggctcaatggaggtaaaaataatctatctattg |
317867 |
T |
|
| Q |
119 |
ttattattaaatttgattgactagtctttgttcataatgtaccttgttggttgttcaagtgtcctgaaattaatgtgacaactatttttgtgcttttatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
317866 |
ttattattaaatttgattgactagtctttgttcataatgtaccttgttggttgttcaagtgtcctgaaattaatgtgacaactatttttgtgc-tttatt |
317768 |
T |
|
| Q |
219 |
taatttgaaagtcctatagtata |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
317767 |
taatttgaaagtcctatagtata |
317745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 28 - 100
Target Start/End: Complemental strand, 11088170 - 11088098
Alignment:
| Q |
28 |
ttttactattactttgttgaagctcaacattccaaagaaacacttccccttcttctttggctcaatggaggta |
100 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| ||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
11088170 |
ttttactattactttgtggaagctcatcattctaaagaaacattgcctcttcttctttggctcaatggaggta |
11088098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University