View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18321_low_24 (Length: 245)
Name: NF18321_low_24
Description: NF18321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18321_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 41425748 - 41425538
Alignment:
| Q |
17 |
cacatgttaggacattgcgccgtcaatggaccaaatcatatccctctagtagccaatcactgcatgatcatcgtcagacagtgatccactaatt-gcgtt |
115 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || || |
|
|
| T |
41425748 |
cacaggttaggacgctgcgccgtcaatggaccaaatcatatccctctagtagccaatcactgcatgatcatcgtcag----tgatccactaatttgcttt |
41425653 |
T |
 |
| Q |
116 |
gataatctctcagtaatgcaatgagaaaggtagacaatcaaatataataaatccatcattctactcgacgtcacaatgtttgcagatacatcaccaactc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41425652 |
gataatctctcagtaatgcaatgagaaaggtagacaatcaaatataataaatccatcattctactcgacgtcacaatgtttgcagatgcatcaccaactc |
41425553 |
T |
 |
| Q |
216 |
tggccgttatctctg |
230 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
41425552 |
cgaccgttatctctg |
41425538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University