View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18321_low_27 (Length: 237)
Name: NF18321_low_27
Description: NF18321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18321_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 219
Target Start/End: Complemental strand, 14334146 - 14333929
Alignment:
| Q |
14 |
ataatactctttagaaacatacacaaacccaaaaacaccaataaaacaaattgatttaattcatatacaccatcggatcgttaattggttgtgatttgtt |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14334146 |
ataatactctttagaaacatacataaacccaaaaacaccaataaaacaaattgatataattcatatacaccatcggatcgttaattggttgtgatttgtt |
14334047 |
T |
 |
| Q |
114 |
gacagtataaaactttctacctagaccatgtatca------------aaataaataacactacatcatatcataattcaaatggagtggcaaactttacc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14334046 |
gacagtataaaactttctacctagaccatgtatcaaaattaaactcaaaataaataacactacatcatatcataattcaaatggagtaccaaactttacc |
14333947 |
T |
 |
| Q |
202 |
attttggagacacatttg |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14333946 |
attttggagacacatttg |
14333929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University