View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18322_low_16 (Length: 374)
Name: NF18322_low_16
Description: NF18322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18322_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 12 - 170
Target Start/End: Complemental strand, 36025142 - 36024983
Alignment:
| Q |
12 |
acgtctttttgatatagtaccactttggattttgtaccgtcagatcaaaagcaattacaaatctcagcgatctttgattctttaacctatgctcttgtta |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36025142 |
acgtctttttgatatagaaccactttggattttgtaccgtcagatcaaaagcaattacaaatctcagcgatctttgattctttaacctgtgctcttgtta |
36025043 |
T |
|
| Q |
112 |
gcattttccaaatgt-ttttattagcatttgaaatatcaaatggttcgatctaaatattt |
170 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36025042 |
gcattttccaaatgttttttattagcatttgaaatatcaaatggttcgatctaaatattt |
36024983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 209 - 349
Target Start/End: Complemental strand, 36024927 - 36024787
Alignment:
| Q |
209 |
ataactggtagacttgaaagtaagaatgcatgcaagcaataattaccacccttcataaaacatttgaagtgattatcaatcgggttgcgtatatacatta |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36024927 |
ataactggtagacttgaaagtaagaatgcatgcaagcaataattaccacccttcataaaacatttgaagtgattataaatcgggttgcgtatatacatta |
36024828 |
T |
|
| Q |
309 |
atacgagtaacaatggaagatccggtcaaaataatatctct |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36024827 |
atacgagtaacaatggaagatccggtcaaaataatatctct |
36024787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University