View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18323_high_22 (Length: 288)
Name: NF18323_high_22
Description: NF18323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18323_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 26 - 284
Target Start/End: Complemental strand, 34142129 - 34141869
Alignment:
| Q |
26 |
gttagaggagcctcttgattcacc--aagtaatcatctcagttataatttcaggtgaaaagaagaaaatgccaatggaaatgactcccaatttgttcatt |
123 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34142129 |
gttagaggagcctcttgattcccccgaagtaatcatctcagttataatttcaggtgtaaagaagaaaatgccaatggaaatgactcccaatttgttcatt |
34142030 |
T |
 |
| Q |
124 |
tgcaatgaaaaattgaatgcaacaggtatgtttatcattattattacatgtggcttcatgcaattgtatgcgcttacattaaccttttgattgcagggcc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34142029 |
tgcaatgaaaaattgaatgcaacaggtatgtttatcattattattacatgtggcttcatgcaattgtacgcgcttacattaaccttttgattgcagggcc |
34141930 |
T |
 |
| Q |
224 |
gccagagattattattaagaaagagtataatgaagatgaaactgtgacctctgtgctgctc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
34141929 |
gccagagattattattaagaaagagtataatgaagatgaaactgtgacctgtgtggtgctc |
34141869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University