View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18323_low_33 (Length: 242)
Name: NF18323_low_33
Description: NF18323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18323_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 7 - 232
Target Start/End: Original strand, 40034714 - 40034939
Alignment:
| Q |
7 |
gtagcataggccaacttgtctaaagacttttcattaccggagtcaaccgttgattttcatctaacagagtcaaagatttttcatttgttgccacttttct |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40034714 |
gtagcattggccaacttgtctaaagacttttcattaccggagtcaaccgttgattttcatctaacagagtcaaagatttttcatttattgccacttttct |
40034813 |
T |
 |
| Q |
107 |
tcaatttagaaacaagcaagtgttaacttcatctaattatattgctgttaaaggttaggatttttgagttgttgatcaattagaatatgaatgttaatta |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40034814 |
tcaattaagaaacaagcaagtgttaacttcatctaattatattgctattaaaggttaggatttttgagttgttgatcaattagaatatgaatgttaatta |
40034913 |
T |
 |
| Q |
207 |
agtttaaattttttgtagttgttgat |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40034914 |
agtttaaattttttgtagttgttgat |
40034939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University