View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18324_high_5 (Length: 257)
Name: NF18324_high_5
Description: NF18324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18324_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 114 - 230
Target Start/End: Complemental strand, 22789582 - 22789470
Alignment:
| Q |
114 |
cttattactattgggtctagagataattagaatatttatgtcgcaattgctagagtagagaagtgtctcatgtgatctacggtggacggaccgatagtta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
22789582 |
cttattactattgggtctagagataattagaatatttatgtcgcaattgctagagtagagaagtgtctcatgtgatctacggt----gggccgatagtta |
22789487 |
T |
 |
| Q |
214 |
aacacagctcaaaacat |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
22789486 |
aacacagctcaaaacat |
22789470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 12 - 123
Target Start/End: Complemental strand, 22790076 - 22789965
Alignment:
| Q |
12 |
agaacctgtgttactgcttttgattgtgttgtgtgtatgagattgtgggcttatggccaaggacaaaaggcaaatagacaacnnnnnnntggcacatacc |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22790076 |
agaacgtgtgttactgcttttgattgtgttgtgtgtatgagattgtgggcttatggccaaggacaaaaggcaaatagacaacaaaaaaatggcacatacc |
22789977 |
T |
 |
| Q |
112 |
tacttattacta |
123 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22789976 |
tacttattacta |
22789965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 158 - 187
Target Start/End: Original strand, 32191419 - 32191448
Alignment:
| Q |
158 |
aattgctagagtagagaagtgtctcatgtg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32191419 |
aattgctagagtagagaagtgtctcatgtg |
32191448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 1029168 - 1029124
Alignment:
| Q |
156 |
gcaattgctagagtagagaagtgtctcatgtgatctacggtggac |
200 |
Q |
| |
|
||||||||||| || |||||||||| |||||||||||| |||||| |
|
|
| T |
1029168 |
gcaattgctagggtggagaagtgtcccatgtgatctacagtggac |
1029124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University