View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18324_high_6 (Length: 239)
Name: NF18324_high_6
Description: NF18324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18324_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 40620367 - 40620492
Alignment:
| Q |
1 |
cttgctgcttctgacccttgtcttgttctcacttctgatccaaaacctcgtcttcgttggactactgaccttcaccaacgttttgttgatgctgtcactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40620367 |
cttgctgcttctgacccttgtcttgttctcacttctgatccaaaacctcgtcttcgttggactactgaccttcaccaacgctttgttgatgctgtcactc |
40620466 |
T |
 |
| Q |
101 |
aacttggtggtcctaccagtaactaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40620467 |
aacttggtggtcctaccagtaactaa |
40620492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 12 - 113
Target Start/End: Original strand, 10196588 - 10196689
Alignment:
| Q |
12 |
tgacccttgtcttgttctcacttctgatccaaaacctcgtcttcgttggactactgaccttcaccaacgttttgttgatgctgtcactcaacttggtggt |
111 |
Q |
| |
|
|||||||||||||||| | ||| ||||||||||||||||||||||||||||| || | || ||||||||||||||||||| ||||| ||||| ||| |
|
|
| T |
10196588 |
tgacccttgtcttgttttgactgctgatccaaaacctcgtcttcgttggactcaagatttgcatgaacgttttgttgatgctgttactcagcttggaggt |
10196687 |
T |
 |
| Q |
112 |
cc |
113 |
Q |
| |
|
|| |
|
|
| T |
10196688 |
cc |
10196689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 20 - 107
Target Start/End: Original strand, 15568538 - 15568625
Alignment:
| Q |
20 |
gtcttgttctcacttctgatccaaaacctcgtcttcgttggactactgaccttcaccaacgttttgttgatgctgtcactcaacttgg |
107 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||||||||||| ||| || || ||||||||||||||||||| ||||| ||||| |
|
|
| T |
15568538 |
gtcttgttcttacaactgacccaaaacctcgtcttcgttggactgttgaactccatgaacgttttgttgatgctgttactcagcttgg |
15568625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University