View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18324_high_7 (Length: 204)
Name: NF18324_high_7
Description: NF18324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18324_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 130
Target Start/End: Original strand, 41526843 - 41526956
Alignment:
| Q |
17 |
tgaagatagttgaagaaggtgctgctgatgcaaccttgtttgttgttctgcaggattagataaaaagttttgttttcgatattattgcaaactcaaaggt |
116 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
41526843 |
tgaagatagttgaaaaaggtgctgctgatgcaaccttgtttgttgctctgcagaattaggtaaaaagttttgtttttgatactattgcaaactcaaaggt |
41526942 |
T |
 |
| Q |
117 |
tactcaattcaaag |
130 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41526943 |
tactcaattcaaag |
41526956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University