View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18324_low_9 (Length: 204)

Name: NF18324_low_9
Description: NF18324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18324_low_9
NF18324_low_9
[»] chr1 (1 HSPs)
chr1 (17-130)||(41526843-41526956)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 130
Target Start/End: Original strand, 41526843 - 41526956
Alignment:
17 tgaagatagttgaagaaggtgctgctgatgcaaccttgtttgttgttctgcaggattagataaaaagttttgttttcgatattattgcaaactcaaaggt 116  Q
    |||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||||| |||| ||||||||||||||||||    
41526843 tgaagatagttgaaaaaggtgctgctgatgcaaccttgtttgttgctctgcagaattaggtaaaaagttttgtttttgatactattgcaaactcaaaggt 41526942  T
117 tactcaattcaaag 130  Q
    ||||||||||||||    
41526943 tactcaattcaaag 41526956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University