View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18325_high_20 (Length: 238)
Name: NF18325_high_20
Description: NF18325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18325_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 143 - 222
Target Start/End: Complemental strand, 37245345 - 37245266
Alignment:
| Q |
143 |
cttgaaatgaattccttttagtccacgtttagtgtctaacaattttttgttcccaccatatctatatgggacttataatt |
222 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37245345 |
cttgaaatgaattccttatagtccacgtttagtgtctaacaattttttgttcccaccatatctatatgggacttataatt |
37245266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 13 - 81
Target Start/End: Complemental strand, 37245475 - 37245407
Alignment:
| Q |
13 |
acagatacctaatagatagatagctcatataataatgggtacaaatccatagcactggattggagatgc |
81 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37245475 |
acagatagctaatagatagatagctcatataataatgggtacaaatccatagcactggattggagatgc |
37245407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University