View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18325_high_21 (Length: 224)

Name: NF18325_high_21
Description: NF18325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18325_high_21
NF18325_high_21
[»] chr2 (1 HSPs)
chr2 (1-134)||(12925741-12925874)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 12925741 - 12925874
Alignment:
1 atacgatgctgagaattacacttactgaaacatcttcgttgagattttcttcagtgatctcagaaatcagcgataaatcaaccgattcttcagaaaacga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12925741 atacgatgctgagaattacacttactgaaacatcttcgttgagattttcttcagtgatctcagaaatcagcgataaatcaaccgattcttcagaaaacga 12925840  T
101 agcagatgaagaattcacgctcctgtttgagatc 134  Q
    |||||||||||||||||||||| |||||||||||    
12925841 agcagatgaagaattcacgctcttgtttgagatc 12925874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University