View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18325_high_21 (Length: 224)
Name: NF18325_high_21
Description: NF18325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18325_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 12925741 - 12925874
Alignment:
| Q |
1 |
atacgatgctgagaattacacttactgaaacatcttcgttgagattttcttcagtgatctcagaaatcagcgataaatcaaccgattcttcagaaaacga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12925741 |
atacgatgctgagaattacacttactgaaacatcttcgttgagattttcttcagtgatctcagaaatcagcgataaatcaaccgattcttcagaaaacga |
12925840 |
T |
 |
| Q |
101 |
agcagatgaagaattcacgctcctgtttgagatc |
134 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
12925841 |
agcagatgaagaattcacgctcttgtttgagatc |
12925874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University