View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18325_low_12 (Length: 386)
Name: NF18325_low_12
Description: NF18325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18325_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 117 - 341
Target Start/End: Original strand, 39442897 - 39443119
Alignment:
| Q |
117 |
ttccttgaatgatttcaatgtccatggtttcttctgtctcatatttataattgatttatcactaaaaaccattaatgaggattctgggaaaaacaaaagc |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39442897 |
ttccttgaatgatttcaatgcccatggtttcttctgcctcatatttataattgatttatcactaaaaaccattaatgaggattctgggaaaaccaaaagc |
39442996 |
T |
|
| Q |
217 |
ctataagagagatggagattttcccgataacatgtccattgagttttctgtagatttatttcagtcaattgtcaattaaatgggagattttttatttaaa |
316 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39442997 |
cta--agagagatggagattttcccgatgacatgtccattgagttttctgtagatttatttcagtcaattgtcaattaaatgggatattttttatttaaa |
39443094 |
T |
|
| Q |
317 |
gaggcctgtgcttttcaaattctgc |
341 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39443095 |
gaggcctgtgcttttcaaattctgc |
39443119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 39442817 - 39442898
Alignment:
| Q |
1 |
gttcacgaatcacaaacgcaaacggcaaaccgcataggaaaaaagaaagattaggattgtttgaactttgaattgcagaatt |
82 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39442817 |
gttcacgaatcacaaacgcaaacggcaaatcgcagaggaacaaagaaagatcaggattgtttgaactttgaattgcagaatt |
39442898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 80 - 137
Target Start/End: Original strand, 19287185 - 19287242
Alignment:
| Q |
80 |
attttagtacacaaagattcggttttagataatagagttccttgaatgatttcaatgt |
137 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19287185 |
attttagtacacaaatattcagttttagataatagagtttcttgaatgatttcaatgt |
19287242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University