View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18325_low_18 (Length: 255)
Name: NF18325_low_18
Description: NF18325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18325_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 237
Target Start/End: Complemental strand, 41379655 - 41379432
Alignment:
| Q |
14 |
cagagagaccaaaatccaaattaagatcgaaattctgtttaatcttgttggatttggcgtgttcgagatcggattcttgaacaacaaaagcatatgatgt |
113 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||| || |
|
|
| T |
41379655 |
cagagagaccgaaatccaaattaagatcgaaattctgtttagtcttgttggatttggcgtgttcgagatcagattcttgaacaacaaaaacatatgaagt |
41379556 |
T |
 |
| Q |
114 |
gtctaagctaatggttggcatatcattagacatgattttactgccaaaatggtgtggtctgagggggaagtgactcacattacttaagcatatgatgtgg |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41379555 |
gtctaagctaatggttagcatatcattagacatgattttactaccaaaatgatgtggtctgagggggaagtgactcacattacttaagcatatgatgtgg |
41379456 |
T |
 |
| Q |
214 |
ggttcgattattgacttatgcgta |
237 |
Q |
| |
|
||||||| |||||||||||||||| |
|
|
| T |
41379455 |
ggttcgactattgacttatgcgta |
41379432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University