View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18325_low_19 (Length: 250)
Name: NF18325_low_19
Description: NF18325
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18325_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 41379026 - 41378807
Alignment:
| Q |
1 |
agaatatgctgaagacctacaaaagaagatcacgagtgcaaagtttaactttaatgatcgttcattggctttgttggaatgcggggaggacggctaataa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| || |
|
|
| T |
41379026 |
agaagatgctgaagacctacaaaagaagatcacgagtgcaaagtttaactttaatgatcgttcattggctttgttggaa-----------cgactaaaaa |
41378938 |
T |
|
| Q |
101 |
attgttccaaaggggtaggcgtcttgtttggcataccaccttgtgggttatttggagggctaggaataaccgtgcttttaacaatgtggtaagttcagcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||| || |
|
|
| T |
41378937 |
attgttccaaaggggtaggcgtcttgtttggcataccaccttgtgggttatttggagggataagaataaccgtatttttaacaatgtggtaagttcaacg |
41378838 |
T |
|
| Q |
201 |
gaggagatttttgatgagattaaagtgttga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41378837 |
gaggagatttttgatgagattaaagtgttga |
41378807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 58 - 205
Target Start/End: Complemental strand, 47337150 - 47337003
Alignment:
| Q |
58 |
tcgttcattggctttgttggaatgcggggaggacggctaataaattgttccaaaggggtaggcgtcttgtttggcataccaccttgtgggttatttggag |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47337150 |
tcgttcattggctttgttggaatgcggggaggacgactagtaaattgtttcaaatgggtaggcgtcttgtttggcataccaccttgtgggttatttggag |
47337051 |
T |
|
| Q |
158 |
ggctaggaataaccgtgcttttaacaatgtggtaagttcagcggagga |
205 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
47337050 |
ggctaggaataaccgtatttttaacaatgtggtaagtttagcggagga |
47337003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 42519415 - 42519358
Alignment:
| Q |
1 |
agaatatgctgaagacctacaaaagaagatcacgagtgcaaagtttaactttaatgat |
58 |
Q |
| |
|
|||| ||||||| ||||| ||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
42519415 |
agaagatgctgaggacctgcaaaagaagatcatgagtgcaaagtttgactttaatgat |
42519358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University