View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18327_high_2 (Length: 227)
Name: NF18327_high_2
Description: NF18327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18327_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 13 - 208
Target Start/End: Complemental strand, 44891669 - 44891470
Alignment:
| Q |
13 |
ataattctaacagacacaaca---gtggcactcaatgaatggtgaacagaataaagggctaagatttaagaattacttcatattactttatattaagaaa |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44891669 |
ataattctaacagacacaacaacagtggcactcaatgaatggtgaacagaataaagggctaagatttaagaattacttcacattactttatattaagaaa |
44891570 |
T |
 |
| Q |
110 |
tgatattttttaaattcaatgtgtcaaattaccacatatttcacaagtaaag-aaatatgtggtctagaagaattgcaattcatgcctcaagtcaaaaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44891569 |
tgatattttttaaattcaatgtgtcaaattaccacatatttcacaagtaaagaaaatatgtggtctagaagaattgcaattcatgcctcaagtcaaaaaa |
44891470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University