View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18327_low_2 (Length: 287)
Name: NF18327_low_2
Description: NF18327
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18327_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 37990070 - 37989821
Alignment:
| Q |
18 |
agaagcaacccggtaaagagaggcggaaatgagccgtaagattctggtattgtgccggagagttggttatcgttgaatgcgattccagcgagggttggga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37990070 |
agaagcaacccggtaaagagaggcggaaatgagccgtaagattctggtattgtgccggtgagttggttatcgttgaatgcgattccagcgagggttggga |
37989971 |
T |
 |
| Q |
118 |
tagttgagagtgaagcggggaggggaccggtgagtttgttgctattgaaggagatggttactagtgttttgatctgtgagagagtgttaggtatctcccc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37989970 |
tagttgagagtgaagcggggaggggaccggtgagtttgttgctattgaaggagatggttactagtgttttgatctgtgagagagtgtaaggtatctcccc |
37989871 |
T |
 |
| Q |
218 |
ggagatgttggtttggatgatgtagatataattgagtttggagagtttgg |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37989870 |
ggagatgttggtttggatgatgtagatataattgagtttggagagtttgg |
37989821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 98 - 267
Target Start/End: Complemental strand, 37994174 - 37994005
Alignment:
| Q |
98 |
gattccagcgagggttgggatagttgagagtgaagcggggaggggaccggtgagtttgttgctattgaaggagatggttactagtgttttgatctgtgag |
197 |
Q |
| |
|
||||||||||||| | || | |||||||||||| |||||||||||||| |||||||||||| ||| | |||||||||||| |||||||||| |||| |
|
|
| T |
37994174 |
gattccagcgaggttaggtagagttgagagtgatgcggggaggggaccagtgagtttgttgtcgctgatgtcgatggttactagggttttgatctctgag |
37994075 |
T |
 |
| Q |
198 |
agagtgttaggtatctccccggagatgttggtttggatgatgtagatataattgagtttggagagtttgg |
267 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
37994074 |
agagtgttaggtatctcgccggagatgttggtttggatgatgtagatggaattgagtttggtgaggttgg |
37994005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 229
Target Start/End: Complemental strand, 38013683 - 38013577
Alignment:
| Q |
123 |
gagagtgaagcggggaggggaccggtgagtttgttgctattgaaggagatggttactagtgttttgatctgtgagagagtgttaggtatctccccggaga |
222 |
Q |
| |
|
||||||| || |||||||||||| || ||||||||| | | |||| |||| || || ||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
38013683 |
gagagtgtagtggggaggggaccagttagtttgttgttgtagaagtcgatgcgtaagagcgttttgatctgtgagagggtgtttggtatctcgccggaga |
38013584 |
T |
 |
| Q |
223 |
tgttggt |
229 |
Q |
| |
|
||||||| |
|
|
| T |
38013583 |
tgttggt |
38013577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University