View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18328_high_18 (Length: 331)
Name: NF18328_high_18
Description: NF18328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18328_high_18 |
 | |
|
| [»] scaffold0649 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0649 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 18 - 314
Target Start/End: Original strand, 6374 - 6667
Alignment:
| Q |
18 |
gcttcaatttcttcatttatagcacaaacatttatattcttgatgtgtatcttttagggtttattttttcttgtcttcttcagataacatttgaatcaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6374 |
gcttcaatttcttcatttatagcacaaacatttatattcttgatgtgtatcttttaggtttt---ttttcttgtcttcttcagataacatttgaatcaac |
6470 |
T |
|
| Q |
118 |
acactgcttgatcattatattctttgtgtaaagcaagcaaaagtctccaattctatataactgaaattgcctctgtcactcatagttctttgactactct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6471 |
acactgcttgatcattatattctttgtgtaaagcaagcaaaagtctccaattctatataactgaaattgcctttgtctctcatagttctttgactactct |
6570 |
T |
|
| Q |
218 |
ttttgttatgcgccatagcaatccaacaatctgtctctcagtcacaatggaaggtgcatcgcatatccgacttcttgaattgatttttgttttgaaa |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6571 |
ttttgttatgcgccatagcaatcgaacaatctgtctctcggtcacaatggaaggtgcatcgcatatccgacttcttgaatcgatttttgttttgaaa |
6667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 22 - 129
Target Start/End: Original strand, 20968716 - 20968821
Alignment:
| Q |
22 |
caatttcttcatttatagcacaaacatttatattctt---gatgtgtatcttttagggtttattttttcttgtcttcttcagataacatttgaatcaaca |
118 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| ||||| ||||||| ||||||||| |||||||| ||||| || |||||||||||||| |||| |
|
|
| T |
20968716 |
caatatcttcatttatagcacaaacaattatgttcttcttgatgtgtttcttttagg-----ttttttctcgtcttttttagataacatttgaagcaact |
20968810 |
T |
|
| Q |
119 |
cactgcttgat |
129 |
Q |
| |
|
||||||||||| |
|
|
| T |
20968811 |
cactgcttgat |
20968821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University