View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18328_high_34 (Length: 244)
Name: NF18328_high_34
Description: NF18328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18328_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 66 - 229
Target Start/End: Complemental strand, 9973113 - 9972950
Alignment:
| Q |
66 |
ggagggagtacttcagtttaatttagcacaacatttcccatgtgaatcctttaggcgtgtaacataaatgcaggccacaaaatgcttaaatttcattttt |
165 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9973113 |
ggaggtagtacttcagtttaatttagcacaacatttcccatgtgaatcctttaggtgtgtaacataaatgcaggccacaaaatgcttagatttcattttt |
9973014 |
T |
|
| Q |
166 |
tacagttgagtctgagcttatcaaataaatttgaatgtaaaatcaaactactactagttagtag |
229 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9973013 |
tacagtcgagtctgagcttatcaaataaatttgaatgtaaaatcaaactactactagttagtag |
9972950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University