View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18328_high_34 (Length: 244)

Name: NF18328_high_34
Description: NF18328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18328_high_34
NF18328_high_34
[»] chr5 (1 HSPs)
chr5 (66-229)||(9972950-9973113)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 66 - 229
Target Start/End: Complemental strand, 9973113 - 9972950
Alignment:
66 ggagggagtacttcagtttaatttagcacaacatttcccatgtgaatcctttaggcgtgtaacataaatgcaggccacaaaatgcttaaatttcattttt 165  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||    
9973113 ggaggtagtacttcagtttaatttagcacaacatttcccatgtgaatcctttaggtgtgtaacataaatgcaggccacaaaatgcttagatttcattttt 9973014  T
166 tacagttgagtctgagcttatcaaataaatttgaatgtaaaatcaaactactactagttagtag 229  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9973013 tacagtcgagtctgagcttatcaaataaatttgaatgtaaaatcaaactactactagttagtag 9972950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University