View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18328_low_30 (Length: 270)
Name: NF18328_low_30
Description: NF18328
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18328_low_30 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 270
Target Start/End: Complemental strand, 55289609 - 55289346
Alignment:
| Q |
7 |
tccaagaatatacaccgacaaaatacaattctacctctacactttctaggttggtattctattgcgttacttgctgtctcacaaattgattgagtaaact |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55289609 |
tccaacaaaatacaccgacaaaatacaattctacctctacactttctaggttggtattctattgggttacttgctgtctcacaaattgattgagtaaact |
55289510 |
T |
|
| Q |
107 |
accaatttcgaccctctgaaattggtcttaaaattatgaatattttcaagaagcctttattgatagtaaattcttaattataacaaccaacttcatagtc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55289509 |
accaatttcgaccctctgaaattggtcttaaaattatgaatcttttcaagaagcctttattgatagtaaattcttaattataacaaccaacttcatagtc |
55289410 |
T |
|
| Q |
207 |
taatacaatgaccttttttgaaatattcataacatcaaagatctatttaagagtatttcacaaa |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55289409 |
taatacaatgaccttttttgaaatattcataacatcaaagatctatttaagagtatttcacaaa |
55289346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University